Proove Logo
  • Home
    • Opioid Risk
    • Pain Perception
    • Drug Metabolism (PGx)
    • Opioid Risk
    • Pain Perception
    • Drug Metabolism (PGx)
  • Proove AI
  • News
  • Leadership
  • Contact
LoginBuy Now

Creating a more predictive
& personalized future
of medicine

Our Mission: Every adult and child deserves inclusive and equitable access to personalized medicine testing and analytics to promote optimal health throughout life.

Our Approach: We use advanced analytics to evaluate genetic and clinical information through one of the world's largest clinical-genetic outcomes datasets to deliver on this commitment.

Buy Now
Add to My Practice

Get the KidSafe Test for just $299 with code KIDSAFE299 at checkout.

200,000+Patients Tested
96%Accuracy1,2
$3,210Per Patient Cost Savings3
50%of Risk for Addiction & Variability in Pain Perception Due to Genetic Factors4,5,6,7
#4Leading Cause of Death in the U.S. Is Adverse Drug Events8
Our Patients

Real Patients. Real Progress.

Hear from patients about their experiences with Proove and how personalized insights have helped inform their journey.

Real PatientsReal OutcomesReal Stories

“Years ago… I was able to take part in a swab… for personalized pain health care and it changed my life. I'm currently working on completing my graduate program, was able to get married and have a life I didn't believe was a possibly before that intervention. There was a point where everything was being thrown at the wall and I wanted everything to stop. I'm thankful I have this beautiful life now. I'm terribly sad to report that upon moving to a new state for work, I'm finding more intervention based on kickbacks for non-supported interventional therapy and not science that would decrease costs, personalize results and reduce the impacts of improper medication management and help our economy. I want to say thank you so very much for helping me and my former doctor (who I credit for using my genetic profile in treatment planning) on giving me a chance at life. I still live with SLE and CRPS, but I have made a phenomenal difference for others including within Employee Engagement and telling my story to medical boards advocating for more use of personalized medicine and gene study in treatment. Thank you from me and my family!

Ray W. — California

“My husband was going to have back surgery and was going to have the potential to have a lot of pain. Knowing my husband's narcotic risk was a great concern of mine. I had some concerns that he could possibly have the potential to be addicted to pain killers. Getting clarity about the Opioid Risk potential set my mind at ease based on the score that came back from the Proove test. With the pharmacogenomic results, the doctors were able to prescribe a safe set of medications for him and avoid a serious side effect.

Carol Y. — Texas

Your browser does not support embedded video.

“Watch Julie's story of how genetic testing changed the way her care team approached her treatment.

Julie Z. — California

The Future of Medicine is Predictive

01

Treatment Decisions

Problem

Empiric prescribing — "let's try this out for 30 days" — means clinicians prescribe a medication without knowing in advance how a patient will respond.

Solution

Proove evaluates the pharmacogenomic factors involved in drug metabolism to better understand how a patient will respond in advance.

Sample Treatment Decisions report — click to open the full PDF
Learn More
02

Risk Assessment

Problem

A subjective survey is often used to assess risk when clinicians are concerned a patient may be at risk for opioid misuse.

Solution

Proove evaluates the genetic, demographic, behavioral, and mental health risk factors to objectively stratify risk for opioid use disorder.

Sample Risk Assessment report — click to open the full PDF
Learn More
03

Pain Assessment

Problem

"Science by Emoji" — clinicians must interpret a subjective 0-10 scale or a set of smiley-to-frowny faces that studies show is unreliable.

Solution

Proove evaluates genetic and clinical factors associated with individual pain sensitivity, treatment response, and recovery time.

Sample Pain Assessment report — click to open the full PDF
Learn More

Precision Intelligence for Everyone
Is Inclusive & Equitable

Order the Test & Complete Your Registration01

Order the Test & Complete Your Registration

Order It Yourself

Ships straight to your door after a quick medical-necessity review.

Or

Go Through Your Clinician

Your doctor places the order — you both get your own report.

→
Collect & Return the Specimen for a Fast Turnaround Time02

Collect & Return the Specimen for a Fast Turnaround Time

Swab your cheek — at home or at your clinician's office — pack the specimen, and send it back with the prepaid label provided.

→
Receive & Use Your Report for Your Entire Life03

Receive & Use Your Report for Your Entire Life

Log in to view your report — add ongoing Proove AI for monthly updates for life.

— Proove AI —

Ask Anything About Proove

ATGCATATATATGCATGCATAT
Same-Hour Result TurnaroundAI-Powered Diagnostic InsightsEMR Integration Ready35+ Insurance Plans Accepted1,500+ Specimens Processed DailySame-Hour Result TurnaroundAI-Powered Diagnostic InsightsEMR Integration Ready35+ Insurance Plans Accepted1,500+ Specimens Processed Daily
The Proove Promise
Our Story

The Proove Promise

We believe that the average is a myth. There is no average person or family. We believe everyone is a unique child of God. We promise to respect the dignity and recognize the merit of individuality. We believe in the power of one– one company, one doctor, one patient – to make a difference.

Latest News

News & Updates

Forbes

April 26, 2024

A Predictive Healthcare Visionary Is Optimistic About Solving America's Opioid Addiction And Chronic Pain Epidemic

Proove Genomics founder Brian Meshkin discusses the “predict-and-prevent” approach to chronic pain and opioid addiction, leveraging advanced genetics and a clinical data bank with over 153,000 patients.

Read More →
View All the News

References

  1. [1] Farah JR, Lee C, Kantorovich S, Smith GA, Meshkin B, et al. (2017) Evaluation of a Predictive Algorithm that Detects Aberrant Use of Opioids in an Addiction Treatment Centre. J Addict Res Ther 8:312. doi:10.4172/2155-6105.1000312
  2. [2] Diatchenko L, Slade GD, Nackley AG, Bhalang K, Sigurdsson A, Belfer I, Goldman D, Xu K, Shabalina SA, Shagin D, Max MB, Makarov SS, Maixner W. Genetic basis for individual variations in pain perception and the development of a chronic pain condition. Hum Mol Genet. 2005 Jan 1;14(1):135-43. doi: 10.1093/hmg/ddi013. Epub 2004 Nov 10. PMID: 15537663.
  3. [3] Relieving Pain in America: A Blueprint for Transforming Prevention, Care, Education, and Research. Washington, DC: The National Academies Press, Institute of Medicine; 2011.
  4. [4] Fillingim RB, Wallace MR, Herbstman DM, Ribeiro-Dasilva M, Staud R. Genetic contributions to pain: a review of findings in humans. Oral Dis. 2008 Nov;14(8):673-82. doi: 10.1111/j.1601-0825.2008.01458.x. PMID: 19193196; PMCID: PMC2667226.
  5. [5] Macgregor AJ, Andrew T, Sambrook PN, Spector TD. Structural, psychological, and genetic influences on low back and neck pain: a study of adult female twins. Arthritis Rheum 2004;51:160-167. [PubMed: 15077255]
  6. [6] American Society of Addiction Medicine. Definition of Addiction. April 2011.
  7. [7] Johnson EO, Fisher HS, Sullivan KA, Corradin O, Sanchez-Roige S, Gaddis NC, Sami YN, Townsend A, Teixeira Prates E, Pavicic M, Kruse P, Chesler EJ, Palmer AA, Troiani V, Bubier JA, Jacobson DA, Maher BS. An emerging multiomic understanding of the genetics of opioid addiction. J Clin Invest. 2024 Oct 15;134(20):e172886. doi: 10.1172/JCI172886. PMID: 39403933; PMCID: PMC11473141.
  8. [8] Swen JJ, van der Wouden CH, Manson LE, et al. A 12-gene pharmacogenetic panel to prevent adverse drug reactions: an open-label, multicentre, controlled, cluster-randomised crossover implementation study. Lancet. 2023;401(10374):347-356.
  • Leadership
  • Proove AI
  • News
  • Ethics
  • Contact
  • Login

Copyright © 2026, Proove Genomics, Inc. — All Rights Reserved.